Proc. Natl. Acad. Sci. USA Vol. 84, pp. 5115-5119, August 1987 Biochemistry Human cDNA clones for an @ subunit of G; signal-transduction protein (receptors /adenylate cyclase /GTP-binding proteins /brain/mRNA) P. Bray*, A. CARTER’, V. Guo*, C. Puckett, J. KAMHOLZ*, A. SPIEGEL’, AND M. NIRENBERG* *Laboratory of Biochemical Genetics, National Heart, Lung, and Blood Institute, “Metabolic Diseases Branch, National Institute of Diabetes, Digestive and Kidney Diseases, *Laboratory of Molecular Genetics, National Institutes of Health, Bethesda, MD 20892 Contributed by M. Nirenberg, March 27, 1987 ABSTRACT Two cDNA clones were obtained from a Agt11 cDNA human brain library that correspond to a; subunits of G signal-transduction proteins (where a, subunits refer to the a subunits of G proteins that inhibit adenylate cyclase). The nucleotide sequence of human brain a; is highly homologous to that of bovine brain a; [Nukada, T., Tanabe, T., Takahashi, H., Noda, M., Haga, K., Haga, T., Ichiyama, A., Kangawa, K., Hiranaga, M., Matsuo, H. & Numa, S. (1986) FEBS Lett. 197, 305-310] and the predicted amino acid sequences are identical. However, human and bovine brain a, cDNAs differ significantly from a, cDNAs from human monocytes, rat glioma, and mouse macrophages in amino acid (88% homol- ogy) and nucleotide (71-75% homology) sequences. In addi- tion, the nucleotide sequences of the 3’ untranslated regions of human and bovine brain a, cDNAs differ markedly from the sequences of human monocyte, rat glioma, and mouse macro- phage a; cDNAs. These results suggest there are at least two classes of aj MRNA. Guanine nucleotide-binding proteins (G proteins) couple receptors for extracellular signals to effectors such as ade- nylate cyclase (1) or CGMP phosphodiesterase (2). G proteins consist of three protein subunits, a, B, and y. a Subunits bind and hydrolyze GTP (1, 2) and display specificity for receptors and effectors. Different proteins, G, and G;, mediate stimu- lation and inhibition, respectively, of adenylate cyclase (where a, and a are the corresponding « subunits). G, and one or more forms of G; are assumed to be present in most mammalian cells (1), whereas the a,-1 subunit of transducin is expressed only in retinal rods (3, 4) and a-2 is expressed only in cones (4). Similarly, a, (a G protein of unknown function) is abundant in brain but not in most of the other tissues that have been examined (5, 6). The nucleotide sequences of cDNA clones for bovine (7, 8), rat (ref. 9; R. Reed, personal communication), mouse (10), and human a, (11, 12) have been reported. R. Reed and coworkers have cloned and sequenced three types of a; cDNA from a rat olfactory epithelium Agtl0 cDNA library (personal communication). Other aj cDNAs from bovine brain (13), bovine pituitary (14), human monocyte (15), mouse macrophage (10), and rat C6 glioma (9) have been sequenced. In addition, the sequences of rat (9) and bovine (16) a, and bovine a,-1 (17-19) and @,-2 (20) cDNAs have been reported. The amino acid sequence homologies of a subunits range from ~40% (a, vs. aj) to ~78% (a,-1 vs. a,-2). In this report, the nucleotide sequence of a human brain a; cDNA is described and is compared with sequences of human monocyte (15), bovine brain (13) and pituitary (14), rat C6 glioma (9), and mouse macrophage (10) a; cDNAs. Two types of a; can be distinguished that differ in 12% of the amino acid The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked ‘advertisement’ in accordance with 18 U.S.C. §1734 solely to indicate this fact. 5115 ————_> + —2+> > ----—> ——> 36 —> ——-2—_» a —> —2—» — iy, > EM M MMM MM M E fu ; rt Lyf 1, ; 1 q 200 400 600 800 1000 1200 1400 +4 @---3---— + #4 + +2. + —_ + <¢+---8 +¢ + +2 —____—__ + Fic. 1. Restriction fragments of BG-4 and BG21-2 a; cDNAs were subcloned into M13mp18 and sequenced. Each arrow repre- sents a subcloned DNA restriction fragment that was sequenced; arrow shafts composed of dashes represent nucleotide sequences from BG21-2 a; cDNA; those with unbroken shafts represent sequences of BG-4 a; cDNA. The numbers shown with some arrows represent the number of subclones of the same type that were sequenced. The number of nucleotide residues in human brain a; cDNA is shown on the scale. E and M represent sites cleaved by EcoRI and Mbo I endonucleases, respectively. residues and possess markedly different 5’ and 3’ untrans- lated sequences that have been conserved during evolution. METHODS A Agtll cDNA library was constructed by a modification of the method of Huynh et al. (21). Poly(A)” RNA was prepared from basal ganglia dissected from a 1-day-old human female brain and was used for cDNA synthesis. Duplex DNA >800 nucleotide pairs in length was ligated to Agtll arms that had been dephosphorylated, and the DNA was packaged. The resulting library contains 10° cDNA recombinants; 90% of the phage contain DNA inserts. Twenty-five thousand phage and 10° Escherichia coli ¥1090 cells were plated per 150-mm Petri dish. Plates were incubated at 42°C for 2 hr and then at 38°C for 4 hr. Phage DNA was transferred to replicate nitrocellulose filters that were incubated in a solution containing 750 mM NaCl/75 mM sodium citrate, 1 mg of bovine serum albumin per ml, 1 mg of polyvinylpyrrolidone per ml, 1 mg of Ficol! per ml, 50 mM sodium phosphate (pH 6.8), 1 mM sodium pyrophosphate, 50 pg of yeast tRNA per ml, and 20% formamide for 16 hr at 42°C. Two probes, designed to hybridize to highly conserved regions of G-a@ subunit cDNAs (22), were synthesized. One probe, 43 nucleotide residues in length, consisted of 32 species of oligodeoxynucleotides, each containing six to eight Abbreviations: a, and a;, a subunits of guanine nucleotide-binding proteins (G proteins) that activate (G,) or inhibit (G,) adenylate cyclase: a@,-1, a subunit of transducin, a G protein of rod photo- receptor cells that activates cGMP phosphodiesterase: «,-2, a subunit of transducin, a G protein of cone photoreceptor cells: a,. a subunit of G,, a G protein of unknown function. 5116 Biochemistry: Bray er al. deoxyinosine residues (5’ TCATETGCTTS ACIATIGTA- cTéTTFCCIGATTCICCIGCICC 3’), The other probe consisted of a single species of oligode- oxynucleotide 50 nucleotide residues in length (5° ACCT- TGAAGATGATGGCGGTCACGTCCTCGAAGCCGTG- GATCCACTTCTT 3’). The 5’ terminal hydroxyl groups of the probes were labeled with **P from [P]ATP catalyzed by polynucleotide kinase. Each probe (~1.5 x 10° cpm/ml, 150 fmol/ml) was added to sets of four replicate 137-mm filters and incubated for 16 hr at 42°C. Each filter was washed three times in a solution contain- ing 60 mM NaCl/6 mM sodium citrate and 0.1% NaDodSO, at 23°C for 20 min per wash, then washed once at 42°C in 60 mM NaCl/6 mM sodium citrate and 0.1% NaDodSO, for 3 min, and then subjected to autoradiography. Phage from plaques yielding positive autoradiographic signals with both probes were cloned. DNA inserts were Proc. Natl. Acad. Sci. USA 84 (1987) excised with EcoRI and subcloned into M13mp18, and partial nucleotide sequences of the subcloned single-stranded phage DNA inserts were determined by the dideoxynucleotide sequencing method (23). The complete nucleotide sequence of clone BG-4 was obtained by use of specific synthetic oligonucleotide primers and by sequencing BG-4 DNA frag- ments partially cleaved by Mbo I endonuclease and then subcloned. Nucleotide or amino acid residues were aligned by using the NUCALN or PRTALN algorithms of Wilbur and Lipman (24). All amino acid residue alignments were performed with a K-tuple size of 1, window size of 20, and a gap penalty of 1. Alignments of nucleotide residues in the coding regions were performed with a K-tuple size of 3, window size of 20, and a gap penalty of 7; for 3’ and 5’ untranslated region alignments a gap penalty of 1 was used. RNA for transfer blots was prepared from adult male human cerebral cortex and liver (25). Poly(A)” RNA was Ser Ala Glu Asp Lys Ala Ala Val Glu Arg Ser Lys Met Ile Asp Arg Asn Leu Arg Glu Asp Gly Glu Lys Ala Ala Arg Glu val Lys 30 AGC GCC GAG GAC AAG GCG GCG GTG GAG CGG AGT AAG ATG ATC GAC COC AAC CIC CGT GAG GAC GCC GAC AAG GCC GCG CCC GAG GTC AAC 90 ce ¢c Te AAG G G A G G Leu Leu Leu Leu Gly Ala Gly Glu Ser Gly Lys Ser Thr Ile Val Lys Gln Met Lys Ile Ile His Glu Ala Gly Tyr Ser Glu Glu Glu 60 CTG CIG CIG CIC GGT _GCT GGT GAA TCT GGT AAA AGT ACA ATT GIG AAG CAG ATG AAA ATT ATC CAT GAA GCT GGT TAT TCA GAA GAG GAG 180 T TG G G A GG G coc c c G ¢ c GA c c c 6G A Cys Lys Gln Tyr Lys Ala Val Val Tyr Ser Asn Thr Ile Gin Ser Ile Ile Ala Ile Ile Arg Ala Met Gly Arg Leu Lys Ile Asp Phe 90 TGT AAA CAA TAC AAA GCT GTG GTC TAC AGT AAC ACC ATC CAG TCA ATI ATT GCT ATC ATT AGG GCT ATG GGG AGG TTG AAG ATA GAC TTT 270 Cc CG G Coe G T ¢ c ¢ G c TGC AA C A ACC c c Gly Asp Ser Ala Arg Ala Asp Asp Ala Arg Gln Leu Phe Val Leu Ala Gly Ala Ala Glu Glu — Gly Phe Met Thr Ala Glu Leu Ala 119 GGT GAC TCA GCC CGG GCG GAT GAT GCA Coc CAA CIC TIT GIG CTA GCI GGA GCT GCT GAA GAA --- GGC TTT ATG ACT GCA GAA CIT GCT 357 c ccT AA ¢c ¢ CAG GG esA CA GTCTCAC C G G CAA @e@ccc ar oc GK Gly Val Ile Lys Arg Leu Trp Lys Asp Ser Gly Val Gin Ala Cys Phe Asn Arg Ser Ang Glu Tyr Gln Leu Asn Asp Ser Ala Ala Tyr 149 GGA GTT ATA AAG AGA TTG TGG AAA GAT AGT GGT GTA CAA GCC TCT TIC AAC AGA TCC CGA GAG TAC CAG CTY AAT GAT TCT GCA GCA TAC 447 c c Cc CG Goce Gct Cc CA G G c TaGcc AAG A Cc c ¢c A T c Tyr Leu Asn Asp Leu Asp Arg Ile Ala Gln Pro Asn Tyr Ile Pro Thr Gln Gln Asp Val Leu Arg Thr Arg Val Lys Thr Thr Gly Ile 179 TAT TIG AAT GAC TTG GAC AGA ATA GCT CAA CCA AAT TAC ATC CCG ACT CAA CAA GAT GIT CTC AGA ACT AGA GIG AAA ACT ACA GGA ATT 537 ec ¢c ¢ GcT T A’ G AGT GAC c A G G ACG ccc A G&G ¢ G G ¢ Val Glu Thr His Phe Thr Phe Lys Asp Leu His Phe Lys Met Phe Acp Val Gly Gly Gln Arg Ser Glu Arg Lys Lys Trp Ile His Cys 209 GTT GAA ACC CAT TIT ACT TTC AAA GAT CIT CAT TIT AAA ATG TTT GAT GIG GGA GGT CAG AGA TCT GAG CGG AAG TGG ATT CAT TGC 627 G G A c ¢c c G c A Cc c G T ce ¢c c Phe Glu Gly Val Thr Ala Ile Ile Phe Cys Val Ala Leu Ser Asp Tyr Asp Leu Val Leu Ala Glu Asp Glu Glu Met Asn Arg Met His 239 TIC GAA GGA GTG ACG GCG ATC ATC TIC TGT GTA GCA CTG AGT GAC TAC GAC CIG GTT CTA GCT GAA GAT GAA GAA ATG AAC CGA ATG CAT 717 T G c ¢c a c c ct coc T T G G Cc G G ¢ Glu Ser Met Lys Leu Phe Asp Ser Ile Cys Asn Asn Lys Trp Phe Thr Asp Thr Ser Ile Ile Leu Phe Leu Asn Lys Lys Asp Leu Phe 269 GAA AGC ATG AAA TIG TTT GAC AGC ATA TGT AAC AAC AAG TGG TTT ACA GAT ACA TCC ATI ATA CTT TIT CTA AAC AAG AAG GAT CIC TTT 807 G GCA ¢ Tt ¢c c c G ¢c c c c 6c c G Glu Glu Lys Ile Lys Lys Ser Pro Leu Thr Ile Cys Tyr Pro Glu Tyr Ala Gly Ser Asn Thr Tyr Glu Glu Ala Ala Ala Tyr Ile Gin 299 GAA GAA AAA ATC AAA AAG AGC CCC CIC ACT ATA TGC TAT CCA GAA TAT GCA GGA TCA AAC ACA TAT GAA GAG GCA GCT GCA TAT ATT CAA 897 G G G ccc T G c c Te T G CA GGec A T Case c c 6 Cys Gln Phe Glu Asp Leu Asn Lys Arg Lys Asp Thr Lys Glu Ile Tyr Thr His Phe Thr Cys Ala Thr Asp Thr Lys Asn Val Gln Phe 329 TGT CAG TTT GAA GAC CTC AAT AAA AGA AAG GAC ACA AAG GAA ATA TAC ACC CAC TIC ACA ‘TCT GCC ACA GAT ACT AAG AAT GIG CAG TTT 987 A A G G gcc a c G c G G c co uc ¢ ¢c c Val Phe Asp Ala Val Thr Asp Val Ile Ile Lys Asn Asn Leu Lys Asp Cys Gly Leu Phe term 349 GTT TTT GAT GCT GTA ACA GAT GTC ATC ATA AAA AAT AAT CTA AAA GAT TGT GGT CIC TTT TAA GITTIGCAGICCATGGTAAAATGCATTTTCAAACC 1085 G c c ¢ c c G c.)U6UclCUCG G6 ¢ c c C G GGGCCACCGGQCCCCTGGCEGGATEGGCCACCGCOG AAATGAGTACTTATATATGGATCICIGTAGACTAGAGICTTGCAGCAACACAGAA TGTAATATAAGGCAAATGCATCTGGGACTIGACCAAAGCTIGTICIGITTIGITTTTTTAACTGA, 1204 GAATTTGT. AAGTAACAGAAGGACCTTTICTTAAATGIGACAGATGGTCCTGCAGTIGAAACTGAAGGACAGTGTTAAAGCIGGGCICTAGTATATTGATGATTICIGCATAAGIGIAAATATGCAAAT 1323 GCTCCARACGTAGGGGAGGGGCTTCGCACAGGCCTCCCTGTTTIGARAGCCIGCOCTIGTCIGAGATGCTGGSTAA TGGCCA TGGTACCCOCTICTIGGGCATCIGTICIGCTTITTAACCAT GTATGTATACATGTATTTIATG 1344 TGTICTTIGTICTGTGCATGAGGG Fic. 2. Nucleotide sequence of human brain a, cDNA and predicted amino acid sequence of a; protein. On the third line of each set of lines are shown the nucleotide residues of human monocyte a cDNA (15) that differ from those of human brain a, cDNA, except for the 3° tail. Nucleotide residues 1-1276 correspond to BG-4 DNA. The regions of BG21-2 DNA that were sequenced correspond to residues 1-500 and 959-1344, The underlined nucleotides are the sites of hybridization of the 43-mer and 50-mer *?P-labeled oligodeoxynucleotide probes. The first 10 nucleotide residues found in BG-4 DNA are GTGCCGAAAG, whereas the first 11 nucleotide residues found in BG21-2 DNA are TGCCGAAAGCG. We do not know whether these nucleotide residues are cloning artifacts, and therefore these residues are not shown. Biochemistry: Bray et ai. L B - Origin Fic. 3. Transfer blot analysis of poly(A)~ = RNA (20 wg per lane). Lane L, adult human liver - 38 RNA; and lane B, aduit human brain RNA. The nitrocellulose filter was incubated with a [°*P]- . RNA probe corresponding to the minus strand -1.6 of 3’ untranslated region of BG21-2 a cDNA (nucleotide residues 1062-1344). The dash marks on the left indicate the chain lengths of -0.4 the RNA markers used: 9.49, 7.46, 4.40, 2.37, 1.35, and 0.33 kilobases; on the right, the chain lengths of the radioactive brain RNA bands are shown. isolated by oligo(dT)-cellulose column chromatography (26), fractionated by formaldehyde/agarase gel electrophoresis, and then blotted onto BA85 nitrocellulose membranes (Schlei- cher & Schuell). A probe specific for human brain a; MRNA corresponding to BG-4 or BG21-2 a; cDNA was obtained as follows: human brain a; cDNA was subcloned into the EcoRI site of pGEM-blue 3 (Promega Biotec, Madison, WI). The recombinant replicative form DNA was converted to linear DNA by incubation with Sca I endonuclease; the cleavage site is 43 nucleotide residues past the termination codon in the 3’ untranslated region of a, cDNA. The synthesis of a (?PJRNA transcript complementary to 251 nucleotide resi- dues in the 3’ untranslated region of human brain a; was catalyzed by SP6 RNA polymerase (27). The nitrocellulose filters were prehybridized for 8 hr at 57°C in a solution containing 750 mM NaCl/75 mM sodium citrate, 5 mM sodium phosphate (pH 6.5), 1 mM EDTA, 0.5 mg of bovine serum albumin per ml, 0.5 mg of Ficoll per ml, 0.5 mg of polyvinylpyrrolidone per ml, 0.1% NaDodSO,, 200 ug of yeast tRNA per ml, and 50% formamide. The [>?7P]RNA a;-specific probe was added (1 x 10° cpm/ml, 4 fmol/ml) and the reaction mixture was incubated 18 hr at 57°C. The filter was washed three times in a solution containing 15 mM NaCl/1.5 mM sodium citrate and 0.1% NaDodSO, at 55°C, then washed two times at 65°C for 20 min each wash, and then subjected to autoradiography for 18 hr with an intensifying screen. RESULTS AND DISCUSSION Sequence of Human Brain a; cDNA. A Agtll cDNA library prepared from total cellular poly(A)* RNA from 1-day-old human basal ganglia was screened with two 7?P-labeled oligodeoxynucleotide probes complementary to highly con- H BRAIN B BRAIN MGCTL»+ H MONOCYTE . R Cé GLIOMA wees M MACROPHAGE «+++ Veeeeens Roteeeee "K were reece c enn eene Proc, Natl. Acad. Sci. USA 84 (1987) $117 served regions of a subunits of G proteins (22). Fourteen of the 575,000 cDNA recombinants screened gave positive signals with both probes. Part of the nucleotide sequence of each positive clone was determined, which led to the iden- tification of 2 a; cDNA clones, BG-4 and BG-21-2, and 11 «, cDNA clones (11). Both strands of human brain BG-4 a; cDNA and part of BG21-2 cDNA were sequenced (Fig. 1). Most regions of BG-21-2 DNA that were sequenced proved to be identical to the corresponding sequence of BG-4 (with one exception noted in the legend to Fig. 2); however, the chain length of BG21-2 was longer than BG-4. The nucleotide sequence of BG-4 human brain a; cDNA (residues 1-1266) and the additional BG-21-2 sequence (residues 1267-1344) are shown in Fig. 2 and are compared with the recently reported nucleotide sequence of human monocyte a; cDNA (15). The first nucleotide of BG-4 corresponds to the 16th residue in the coding region of human monocyte a;. Nucleotide residues 1-1047 comprise an open reading frame coding for 349 amino acid residues followed by a termination codon and 294 additional 3’ untranslated nucleotide residues. Two-hundred and seventy-seven of the nucleotide residues scattered throughout the coding portion of human brain a, cDNA differ from those of human monocyte aj cDNA (27%) (15). How- ever, 221 of the nucleotide substitutions are silent mutations and 56 result in the replacement of 42 of the 349 amino acid residues compared (12%). Little or no homology was found in the nucleotide sequences of the 3’ untranslated regions of human brain and monocyte a; cDNAs (67% of the residues differ). These results show that the nucleotide sequences of human brain and monocyte a; cDNAs differ substantially and suggest that human brain and monocyte a; mRNAs are tran- scribed from different genes. These results agree well with the findings of R. Reed and his colleagues that rat olfactory epithelium contains three types of a; (personal communication). Transfer Blot Analysis of Human a; mRNA. A [*°P]RNA probe complementary to nucleotide residues 1062-1344 in the 3’ untranslated region of BG-21-2 human brain a; cDNA was incubated with human liver and brain poly(A)* RNA that had been fractionated by gel electrophoresis and transferred to a nitrocellulose filter (Fig. 3). The [*7P]RNA probe was ex- pected to hybridize with human brain a; mRNA correspond- ing to BG-4 or BG21-2 cDNA but not to other species of a-mRNA. Two faint, diffuse bands of radioactive liver poly(A)* RNA were detected with chain lengths of 1.7 and 1.0 kb, and one major and three minor radioactive bands of brain poly(A)” RNA were found with chain lengths of 2.2, 3.8, 1.6, and 0.4 kilobases (kb), respectively. The 3.8-kb a; poly(A)” RNA from human brain is similar in size to the 3.9-kb chain length reported for bovine brain aj mRNA (13). SAEDKAAVERSKMI DRNLREDGEKAAREVKLLLLGAGESGKSTIVKOMKIIHKEAGYSEEECKOYK (70) HB AVWYSWTIOSI TAI TRANGRLKIDFGDSARADDARQLE VLAGAABE- “GPMTARLAGVI KRLAKDSGVQACEHRSHEYOLN oY MM te eee ewes LeeVKRe °Ne os hh. “a+ wan weenes Ae "SCr +s +Qe MLPED+ Se ‘ 150 150 150 HB DSAAY YLNDLDRIAQPNY IP TOQDVLRTRVKT'TGIVE-THF'TPKDLHP KMPDVGGORSERKKWIHCFEGVTAI TRCVALSD (229) Fic. 4. Amino acid sequence of a; from human brain compared with a; sequences from bovine brain (13), human monocytes (15), rat C6 glioma cells (9), and mouse macrophages (10). The letters represent the single-letter abbrevia- tions for amino acids. The symbol : represents an amino acid residue that is identical to the residue shown for human brain a; — represents a gap. 5118 Biochemistry: Bray et al. BOVINE TGGCCGGCG TCAGGAGGAATTCGAACGCCTG HUMAN CCGGCAGTCCCGAGTGCTTCCCGCAGAGGGCTG--GTGGTG MOUSE CeCAGG* se eeee—--- 0 CoAGeCeene B CATCCAGAAAGAAAGAATTCACCTGTGITTCGAGGCAGCGCGCCG GGAGCGGAGTGGAG TCGGGCGGGGCCGAAGCCGGGCCGTGGGC-G eusccseecsesCe omen eee een ste mec eens eel-—eceeeesscceessaCe GAC TTCGAGGGAGCGGCAGCCAGCTITCGCTICCTGGCACA ATG TAGAT CGGGCGGCGGCGGAGCGGCGGAACGCGGG ATG eeGCescoeeeCGeeAse ATG oeGCaccecoeCGeeAee ATG EPmw Sam *G-- or eee Fic. 5. Nucleotide residues in the 5’ untranslated regions of bovine brain a@-1 cDNA (13) and human monocyte a;-2 cDNA (15). The symbol - represents a nucleotide residue in rat (9) or mouse (10) a; CDNA that is identical to the residue shown in human monocyte a, CDNA. Rat and mouse nucleotide residues that differ from those of human macrophage cDNA are shown. ATG at the 3’ end of each sequence represents the initiation codon for methionyl-tRNA. These results reveal tissue-specific differences in the expres- sion of human aj-1 mRNA. Comparison of a; Amino Acid Sequences. The predicted amino acid sequence of human brain a; is compared in Fig. 4 with a; amino acid sequences predicted from nucleotide sequences of cDNAs from bovine brain (13), human mono- cytes (15), rat C6 glioma cells (9), and mouse macrophages (10). The predicted amino acid sequence of human brain a; is identical to that of bovine brain a; (13) and differs in only 3 amino acid residues from bovine pituitary a; (14) (not shown). In contrast, human and bovine brain a; differ from human monocyte, rat C6 glioma cells, and mouse a; in ~12% of the amino acid residues. The amino acid sequences of a; from human monocytes, rat, and mouse are closely related (99% homology) and contain a codon for an additional amino acid residue, Gln-117, which is not present in human brain, bovine brain, or bovine pituitary a; cDNAs. These data reveal two types of a; CDNA: a;-1 from human brain, bovine brain (13), and bovine pituitary (14), and a;-2 from human monocytes (15), rat C6 glioma cells (9), and mouse macrophages (10). Thirty-six of the 44 amino acid residues of aj-1 and a;-2 that differ are clustered in two regions: region A (amino acid residues 82-142) with 25 residues that differ and region B (amino acid residues 280-309) with 11 residues that differ. Furthermore, only 55% of the amino acid replacements are conservative replacements (28). Regions A and B contain the greatest diversity in amino acid sequence in the a family of proteins and may contain sites that determine the specificity of G-protein interactions with effectors and receptors, re- spectively (29). The predicted secondary structures of a;-1 and a;-2 based on the parameters of Chou and Fasman (30) differ in inter- esting ways. Amino acid residues 118-124 of a;-1 (the numbering system is that of bovine brain q;-1 shown in Fig. 3) are predicted to form an a-helix that is not present in a;-2. Conversely, amino acid residues 97-100 and 120-123 of ZKEvmwt MACROPHAGE TGAseesesenTooA- Proc. Natl. Acad. Sci. USA 84 (1987) human monocyte, rat, and mouse a;-2 are predicted to form §-turns that are not present in human and bovine q;-1 protein subunits. The differences in predicted secondary structures are located in a variable region of a proteins that is thought to interact with effector molecules. The amino acid sequence of human q;-1 is identical to that of bovine a;-1, whereas the amino acid sequences of human, rat, and mouse q;-2 differ from one another by 3-8 amino acid residues. These amino acid replacements may have resulted from relatively recent mutations during the last 8.5 x 10’ years because human, bovine, and rodent precursors di- verged from a common ancestor ~8.5 x 10’ years ago (33). However, the amino acid sequences of human and bovine a,-1 differ from the sequences of human, rat, and mouse aj-2 in 36 additional amino acid residues, and the mutations that resulted in these amino acid substitutions must have occurred >8.5 x 10’ years ago. Such considerations lead us to speculate that aj-1 and a;-2 mRNA are transcribed from separate genes that originated by duplication of an ancestral a gene much more than 8.5 X 107 years ago and then diverged over a long period of time by accumulation of mutations. The differences between the amino acid sequences of aj-1 and aj-2 are likely to be functionally significant, since the differences apparently have been conserved during evolution. In some ways the relatedness of a;-1 and aj-2 resembles that of a,-1 (17-19) and a,-2 (4, 20), which exhibit 78% amino acid homology and interact with rhodopsin in retinal rods and opsin pigments in cones, respectively. a; Nucleotide Sequences. Comparison of a; cDNA nucleotide sequences from different organisms (not shown here) provides additional evidence for two types of a;. The nucleotide se- quence of human brain aj cDNA closely resembles that of bovine brain (13) and bovine pituitary (14) a; cDNAs (94% homology); in addition, human monocyte (15), rat C6 glioma (9), and mouse macrophage (10) a;-2 cDNA nucleotide sequences closely resemble one another (87-90% homology). However, aj-1 nucleotide sequences differ substantially from those of a;-2. As shown in Fig. 5, the nucleotide sequence of the 5’ untranslated region of bovine brain aj-1 differs markedly from the corresponding sequences of human monocyte, rat C6 glioma, and mouse macrophage aj-2 cDNAs (33% homology). However, the 5’ untranslated nucleotide sequences of aj-2 cDNAs from human monocytes, rat, and mouse closely resem- ble one another, which suggests that the a;-2 5’ untranslated nucleotide sequences have been conserved during evolution. Comparison of the initial nucleotide residues in the 3’ untranslated regions of a; cDNAs (Fig. 6) shows that human and bovine brain (13) a cDNAs are closely related (92% homology) and that human monocyte and rat a, cDNAs are related to one another (83% homology). However, little or no homology was detected between the 3’ untranslated regions of human brain and bovine brain a cDNAs compared to BRAIN TAAGTTTT -GCAGTCC- -ATGGTAAAATGCATTTTCAAACCAAATGAGTACTTATATATGGATCTCIGTA BRAIN TGAs «Ge eGeeGe~-sAAscccasececnoccscnneceeunaceneessseseCneGeceecceueCns MONOCYTE TGAGGGGCAGCGGGGCCTGGCGGGATGGGCCACCGCCGAAT TTGTACCCCCCAACCCCTGAGGAAGATGG C6 GLIOMA TGAsescese4lecescccsehucccesescccensTeoleCecCTeoeneheTansTGescunesens oe eels oe TT CGG*G*sCTeTGCC*ACCCA*TeT+TGs ¢G*TC*GAGGCCCCA HB GACTAGAGTCTTGCAGCAACACAGAATGTAATATAAGGCARATGCATCTGGGACITGACCAAAGTITGTTCTGTTTTGTT BB shh veescennac cece sescc ences saGeneeTe eels ccccnnecceelssesceues ee ene ohean—cee Fic. 6. Nucleotide sequences at the beginning of HM GGGCAAGAAGATCACGCTCcCcGccTeTTceccc -GececrIrrercererrreerererrrerrercaccrececete the 3’ untranslated regions of human brain aj-1 and RG Pewee seenaCoeTecssceTenesccasevcahsoTocusCeoCessGeleeTeccveCevce human monocyte a;-2 cDNAs (15). The nucleotide MM AA++A+*A+GCeCA+GAAG*GIGAGAGA*A*G«s «ATT + Ts GAGACAAAGC *ACCTGCTAT*C*CG*AG*TTTAAAGAAA sequence of bovine brain aj-1 cDNA (13) is compared HB TTTT---TAACTGAAAGTAACAGAAGGACCTTTCT TAAATGTGACAGATGGTCCTGCAGT-TGAAACTGAAGGACAGTGS BBR eecees MDa mee m ane recelTGr ever csrecceGeceGesceeGesGesseesecceseGeeceatsecces Geeoses with the sequence of human brain a,-1 cDNA, whereas the nucleotide sequences of rat (9) and mouse (10) a;-2 HM TCCCCTCA--~-GCTCCAAACGTAGG-cGAGGccTTeccacaccccTcccTerrreaaccerecccrrercteacat-c ©DNAs are compared to the nucleotide sequence of RG PH eee ee CCTCGe eee TeGe Te cccGuavcccessGlensescceasevessCoheehesCheeTossscenscGehe MM AAAAAGAA*AAR HB TTAAAGCTGGGCTCTAGTATATTGATGATTTCTGCATAAGTGTAAATATGCAAATGTATGTATACATGTATTTATG BH see ces cee oncans ee oGealGeese eCosceAavceCAscccosncvecasccvsessceseussccsseeses HM CIGGTAATGGCCATGGTACCCCCTT -CTGGGCATCTGTTCTGGTTTT-TAACCATTIGTCTTGTTCTGTGATGAGGG RG Ce eGeGaccevarnes oe eT eee anececcuaCheesGeesccsCocssesevccans oe ere rGeGoenece human monocyte a;-2 cDNA. TAA or TGA at the 5’ terminus represents termination codons for a; cDNAs. The symbol - represents a nucleotide residue that is identical to the residue shown for human brain a;-1 or human monocyte a;-2 cDNA. Nucleotide residues that differ are shown. Biochemistry: Bray er ai. HUMAN TAAGAAGCGAACCCCCAAATTTAATTAAAGCCTTAAGCAC SG AATTAATTAAAAGTGAAACGTAATTGTACAAGCAGTTAATCACC CecnanrevenvesheGoTAcccccccsveCocccceCescens Poem ener enGesccescceCeceCocesccceecoeGesesea Pear e rane eGeercescrcerescccescceeeeseGGecene Sescece—oeTese ooscesTTeT a B R M H CACCATAGGGCATGATTAACAAAGCAACCTTTCCCTT-Ccc B os R M FIG. 7. Nucleotide sequences at the beginning of the 3’ untrans- lated regions of a, cDNAs from human brain (11) and human liver (12). The human nucleotide sequence is compared with the se- quences of a, cDNAs from bovine brain (7) and bovine adrenal medulla (8), which are identical in this region, and with rat C6 glioma (9) and mouse macrophage (10) cDNAs. TAA at the 5’ terminus represents the termination codon for a, cDNA. The symbol - represents a nucleotide residue that is identical to that shown for human a, cDNA; nucleotide residues that differ are shown. human monocyte, rat, and mouse a;-2 cDNAs. The sequence of the first 25 nucleotide residues from the 3’ untranslated region of mouse a; cDNA matches the initial 3’ untranslated sequences of human monocyte and rat a; cDNAs (92-96% homology), but thereafter, the sequences are not related. As shown in Fig. 7, the nucleotide sequences of the 3’ untranslated regions of human, rat, mouse, and bovine a, cDNAs also are highly conserved (90-93% homology). How- ever, the initial portion of the 3’ untranslated nucleotide sequence of human brain a, cDNA (11, 12) is not related to the 3’ untranslated sequences of human qj-1 or a;-2, rat a, (9), or bovine a@,-1 (17-19) or q-2 (20) cDNAs (not shown). The relatively high homologies in untranslated regions of ;-1, aj-2, or a, MRNAs in different species suggest that the untranslated nucleotide sequences are functional and thus have been conserved during evolution. The 3'-terminal untranslated region of bovine brain aj-1 cDNA contains many repeats of (A+T)-rich sequences similar to the consensus sequences TTATTTAT (34) and TTI(G/A)NNNTTTTTTT (35), which have been found in the 3’ untranslated regions of some species of MRNA and have been proposed to function as signals for rapid turnover of mRNA (36). The (A+T)-rich sequences are less frequent in a and a, and have not been found in human, rat, or mouse aj-2 cDNAs. Whether a;-1 mRNA turns over more rapidly than a;-2 mRNA remains to be determined. The nucleotide sequences in the 3’ untranslated regions of B-actin, cardiac a-actin, c-fos, nerve growth factor, and creatine kinase mRNAs from different organisms also have been conserved during evolution (see ref. 37 for discussion). Different forms of actin and creatine kinase with conserved 3’ untranslated regions have been shown to be the products of separate genes that are expressed in different tissues and at different times during development. Data from a cDNAs have revealed an unexpected diversity in a and a, (7-18). Comparison of human brain and human monocyte (15) aj cDNAs suggests that the two types of human a; are transcribed from separate genes. The nucleotide se- quences of a, cDNAs reveal that a; genes are subject to strong selective pressure in the coding region and the 5’ and 3’ untranslated regions. Comparison of amino acid sequences predicted from a; cDNAs suggests that a;-1 and aj-2 proteins may differ in function as well as in tissue distribution and abundance. We thank Dr. Gerald Zon for synthesizing the oligodeoxynucleo- tide probes. This work has been presented by P.B. in partial fulfillment of the Ph.D. requirements of George Washington University (Wash- ington, DC). e 10. 11. 13. 14. 15. 16. 17. 18. 19, 20. 29. 30. 31. 33. 34. 35, 36. 37. Proc. Natl. Acad. Sci. USA 84 (1987) 5119 Gilman, A. G. (1984) Cell 36, 577-579. Fung, B. K.-K., Hurley, J.B. & Stryer, L. (1981) Proc. Natl. Acad. Sci. USA 78, 152-156. Grunwald, G. B., Gierschik, P., Nirenberg. M. & Spiegel, A. M. (1986) Science 231, 856-859. Lerea, C. L., Somers, D. E., Hurley, J. B., Klock, I. B. & Bunt- Milam, A. H. (1986) Science 234, 77-80. Huff, R. M., Axton, J. M. & Neer, E. J. (1985) J. Biol. Chem. 260, 10864-10871. Gierschik, P., Milligan, G., Pines, M.. Goldsmith, P., Codina, J., Klee, W. & Spiegel, A. (1986) Proc. Natl. Acad. Sci. USA 83, 2258-2262. Nukada, T.. Tanabe, T., Takahashi, H., Noda, M., Hirose, T., Inayama, S. & Numa, S. (1986) FEBS Lert. 195, 220-224, Robishaw, J. D., Russell, D. W., Harris, B. A., Smigel. M. D. & Gilman, A. G. (1986) Proc. Natl. Acad. Sci. USA 83, 1251-1255. Itoh, H., Kozasa, T., Nagata, S., Nakamura, S., Katada, T., Ui, M., Iwai, S.. Ohtsuka, E., Kawasaki, H., Suzuki. K. & Kaziro, Y. (1986) Proc. Natl. Acad. Sci. USA 83, 3776-3780. Sullivan, K. A., Liao, Y.-C., Alborzi, A., Beiderman, B., Chang, F.-H.. Masters, S. B., Levinson. A. D. & Bourne, H. R. (1986) Proc, Natl. Acad, Sct. USA 83, 6687-6691. Bray, P., Carter, A., Simons, C., Guo, V.. Puckett, C.. Kamholz, J., Spiegel, A. & Nirenberg, M. (1986) Proc. Natl. Acad. Sci. USA 83, 8893-8897. Mattera, R., Codina, J., Crozat, A., Kidd, V., Woo. S.L.C. & Birnbaumer, L. (1986) FEBS Lett. 206, 36-42. Nukada, T.. Tanabe. T., Takahashi, H.. Noda, M.. Haga, K., Haga, T., Ichiyama, A.. Kangawa, K., Hiranaga, M., Matsuo, H. & Numa, S. (1986) FEBS Lett. 197, 305-310. Michel, T., Winslow, J. W., Smith, J. A.. Seidman, J. G. & Neer, E. J. (1986) Proc. Natl. Acad. Sci. USA 83, 7663-7667. Didsbury, J. R., Ho, Y.-S. & Snyderman, R. (1987) FEBS Lett. 211, 160-164. Angus, C. W., Van Meurs, K. P., Tsai, $.-C., Adamik. R., Miedel, M. C., Pan, Y.-C. E., Kung, H.-F., Moss, J. & Vaughan. M. (1986) Proc. Natl. Acad. Sct. USA 83, 5813-5816. Tanabe, T., Nukada, T., Nishikawa, Y., Sugimoto, K., Suzuki, H., Takahashi, H., Noda, M., Haga, T., Ichiyama, A.. Kangawa, K., Minamino, N.. Matsuo, H. & Numa, S. (1985) Nature (London) 315, 242-245. Medynski. D. C., Sullivan, K., Smith, D., Van Dop. C., Chang, F.-H., Fung. B. K.-K.. Seeburg, P. H. & Bourne, H. R. (1985) Proc. Natl. Acad. Sci. USA 82, 4311-4315. Yatsunami. K. & Khorana, H. G. (1985) Proc. Natl. Acad. Sci. USA 82, 4316-4320. Lochrie, M. A.. Hurley, J. B. & Simon, M. I. (1985) Science 228, 96-99. Huynh, T. V., Young, R. A. & Davis. R. W. (1985) in DNA Cloning: A Practical Approach, ed. Glover, D. IRL. Oxford), Vol. I. Hurley, J. B., Simon, M. 1, Teplow. D. B.. Robishaw. J. D. & Gilman, A. G. (1984) Science 226, 860-862. Sanger, F., Nicklen, S. & Coulson, A. R. (1977) Proc. Natl. Acad. Set. USA 74, 5463-5467. Wilbur, W. J. & Lipman, D. J. (1983) Proc. Natl. Acad. Sci. USA 80, 726-730. Sargent, T. D., Jamrich, M. & Dawid, I. B. (1986) Dev. Biol. 114, 238-246. Aviv, H. & Leder, P. (1972) Proc. Natl. Acad. Sci. USA 69, 1408-1412. Melton, D. A., Krieg, P. A.. Rebagliati, M. R.. Maniatis. T., Zinn, K. & Green, M. R. (1984) Nucleic Acids Res. 12, 7035-7056. Dayhoff, M. O., Schwartz, R. M. & Orcutt, B. C. (1978) in Atlas of Protein Sequence and Structure, ed. Dayhoff, M. O. (Natl. Biomed. Res. Found., Washington, DC), Vol. 5, Suppl. 3, pp. 345-352. Stryer, L. & Bourne, H. R. (1986) Annu. Rev. Cell Biol. 2, 391-419. Chou, P. Y. & Fasman. G. D. (1978) Annu. Rev. Biochem. 47, 251-276. Masters, S. B., Stroud. R. M. & Bourne, H. R. (1986) Protein Eng. 1, 47-54. Jurnak, F. (1985) Science 230, 32-36. Romero-Herrera, A. E., Lehmann. H.. Joysey, K. A. & Friday. A. E. (1973) Nature (London) 246, 389-395, Caput, D.. Beutler. B., Hartog, K., Thayer. R.. Brown-Shimer. S. & Cerami, A. (1986) Proc. Natl. Acad. Sci, USA 83, 1670-1674. Renan, M. J. (1986) Biosci. Rep. 6, 819-825. Shaw. G. & Kamen, R. (1986) Cell 46, 659-667. Yaffe. D.. Nudel, U., Mayer, Y. & Neuman, S. (1985) Nucleic Acids Res. 13, 3723-3737.